Sequencing:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Variant Assay:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Reporter Assay:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Recombinant:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Luciferase:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Software:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Chromatography:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Polymerase Chain Reaction:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Spectrophotometry:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Electrophoresis:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Binding Assay:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Construct:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
Cloning:Article Title: Protocol for evaluating the impact of non-coding variants on transcription factor binding and gene expression.
Article Snippet: Measure DNA concentration using Qubit dsDNA BR Assay Kit. .. Continued REAGENT or RESOURCE SOURCE IDENTIFIER luc2/NlucP GA Rv IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-ref) IDT N/A 60 bp genomic sequence centered on variant for reporter assay (rs56992000-alt) IDT N/A Gibson assembly Fw primer for 60 bp genomic sequence IDT N/A Gibson assembly Rv primer for 60 bp genomic sequence IDT N/A Recombinant DNA pET-28a(+)-GATA4 Twist Bioscience N/A pGL4.23 [Luc2/minP - firefly luciferase] Promega E8411 pNL1.1.CMV [Nluc/CMV] Vector Promega N1091 GATA4 pTwist CMV BG WPRE Neo Twist Bioscience N/A Software and algorithms Prism 10.4.1 (https://www.graphpad.com/features) GraphPad N/A ImageJ 1.54p (https://imagej.net/ij/) NIH N/A Other Econo-Pac Chromatography columns Bio-Rad 7321010 1.5 mL DNA LoBind tubes Eppendorf 0030108051 PCR tube strips USA Scientific 1402–2400 Greiner culture flasks, tissue culture treated Sigma-Aldrich C6481 Corning cell scrapers Sigma-Aldrich CLS3010 Corning 96 well white polystyrene microplate flat-bottom clear white polystyrene (TC-treated) Sigma-Aldrich CLS3610 Sonicator QSonica Q125 NanoDrop spectrophotometer Thermo Scientific ND-1000 T100 Thermo cycler Bio-Rad 1861096 Electrophoresis Power Supply VWR G-58517 Mini-PROTEAN Tetra Vertical Electrophoresis Cell Bio-Rad 1658004 Sapphire Biomolecular Imager Azure Biosystem 76318–254 Tecan Infinite 200 Pro microplate reader Tecan Group Ltd. 1055090 Name Sequence IR700 dsDNA FW Primer IR700/CTTACGGCGGCATTGGCACG 40 bp genomic sequence centered on variant for binding assay (rs56992000-ref) CTTTGCTTACCTATATTTTC CGTGCCAATGCCGCCGTAAG 40 bp genomic sequence centered on variant for binding assay (rs56992000-alt) CTTTGCTTATCTATATTTTC CGTGCCAATGCCGCCGTAAG luc2/NlucP GA Fw Primer AGACACTAGAGGGTATATAATGGAAG (Continued on next page) 10 STAR Protocols 6, 103874, June 20, 2025 Note: Constant regions used for dsDNA generation and reporter construct cloning are underlined. ..
|
Bio-Rad is a verified supplier 
Bio-Rad manufactures this product 